АНАЛИЗ ЭКСПРЕССИИ ГЕНОВ СТРЕССОУСТОЙЧИВОСТИ В УСЛОВИЯХ ВОЗДЕЙСТВИЯ ЗАСУХИ НА РАСТЕНИЯ БЕРЕЗЫ В ЦЕНТРАЛЬНО-ЧЕРНОЗЕМНОМ РЕГИОНЕ
Аннотация и ключевые слова
Аннотация (русский):
Береза является одной из основных лиственных лесообразующих пород в европейской части России, однако воздействие стресса (в частности, засухи) сильно ограничивает ее распространение. В связи с этим, актуальным представляется выявление механизмов устойчивости с целью отбора перспективных генотипов для их дальнейшего размножения. Целью данной работы было выявление засухоустойчивых генотипов березы повислой (B. pendula Roth.), пушистой (B. pubescens Ehrh.) и их гибридов. Для исследования были взяты образцы березы в возрасте 26 лет, сохранившие жизнеспособность после засух 2010 и 2013 годов. Для анализа устойчивости к засухе листья березы были отобраны в третьей декаде июня 2019 года. Листья растений березы, отобранные в период с оптимальными условиями температуры воздуха и осадков, были использованы в качестве контроля. Предложен модифицированный CTAB метод для выделения РНК. Изучена экспрессия генов, кодирующих белки, участвующие в активации защитных путей клетки под воздействием абиотического стресса (pal, PR-1, PR-10, lea8, DREB2) в период засухи (июнь 2019 г.). Проведено исследование экспрессии генов, кодирующих белки метаболических путей, активирующихся в ответ на абиотический стресс (фенилпропаноидный путь), связанных с патогенезом белков (PR1 и PR10), факторов транскрипции (DREB2) и белков позднего эмбриогенеза (LEA). В результате воздействия засухи было обнаружено значительное увеличение экспрессии генов pal, PR-1, PR-10 и DREB2 в анализируемых образцах; в то же время были выявлены изменения экспрессии гена lea8 для двух из десяти генотипов. Наибольшее увеличение экспрессии для всех пяти генов показано для образцов березы 29-58 и 233, что указывает на развитие адаптивных механизмов у этих генотипов и может характеризовать их как наиболее стабильные. Изученные гены могут быть рекомендованы в качестве маркеров для анализа стрессоустойчивости у различных видов древесных растений

Ключевые слова:
засуха, стрессоустойчивость, экспрессия гена, береза
Текст
Текст произведения (PDF): Читать Скачать

Растения в процессе роста часто сталкиваются с неблагоприятными условиями. Климатические факторы, такие как экстремальные температуры (жара, холод, замерзание), засуха (дефицит осадков, суховеи) и повышенная соленость почв, являются основными абиотическими факторами окружающей среды, которые существенно ограничивают рост и развитие растений. Засуха является широко распространенной проблемой, в том числе, и в ЦЧР. В связи с все нарастающей проблемой усыхания древесных видов и потерей их продуктивности, остро встает вопрос восстановления лесов.

Береза является одной из основных лиственных лесообразующих пород в европейской части России, способной создавать чистые насаждения или смешанные, выходя в первый ярус. Но высота ее достигает только 20 м, и в соперничестве с елью или сосной она часто становится угнетенной породой. Воздействие абиотического стресса, такого как засуха, также является значительным ограничивающим распространение данной породы фактором.

   Экологический стресс может нарушать клеточные структуры и изменять основные физиологические функции [1]. Засуха, соленость и низкие температуры создают осмотический стресс, который может привести к потере тургора. Мембраны становятся дезорганизованными, белки теряют активность или подвергаются денатурации, возникает избыточный уровень активных форм кислорода, что приводит к окислительному повреждению. Как следствие, ингибирование фотосинтеза, нарушение обмена веществ и повреждение клеточных структур способствуют нарушениям роста, снижению фертильности и преждевременному старению [2].

Высшие растения характеризуются активным способом адаптации к неблагоприятным факторам окружающей среды, например, к неблагоприятным условиям водного режима. Реакция на абиотический стресс происходит на всех уровнях организации. Механизмы адаптации включают усиленный рост корневой системы, повышенную способность удерживать воду и закрытие устьиц [2]. Ответ на клеточном уровне включает в себя изменение мембранной системы, модификацию архитектуры клеточной стенки и изменения в клеточном цикле и делении клетки. Физиологические и биохимические стрессовые реакции на дегидратацию, вызванную засухой или засолением, включают подавление роста клеток и фотосинтеза и активацию дыхания. Изменение окислительно-восстановительного метаболизма приводит к снижению АФК и снижению окислительно-восстановительного баланса клеток [3-5].

Биохимический ответ включает накопление осмолитов и белков, которые специфически участвуют в развитии стрессоустойчивости [6]; образуются совместимые растворенные вещества (пролин, рафиноза и глицин-бетаин), которые стабилизируют белки и клеточные структуры и/или поддерживают тургор клетки посредством осмотической регуляции. Таким образом, для компенсации солевого стресса у высших растений накапливается свободный пролин [7], что обеспечивает поддержание фотосинтеза, осморегуляции, макромолекулярную защиту от повреждения и снижение кислотности цитоплазмы клеток [8].

На молекулярном уровне в условиях стресса изменяется экспрессия генов [6, 8, 9], и эпигенетическая регуляция экспрессии играет важную роль в развитии ответной реакции на воздействия окружающей среды [10, 11].

Транскриптомный анализ с использованием технологии микрочипов позволил выявить множество генов, индуцируемых абиотическим стрессом, и эти гены были классифицированы на две основные группы. Одна группа кодирует продукты, которые непосредственно защищают растительные клетки от стресса, то есть функциональные белки. Эти белки, вероятно, участвуют в метаболическом ответе на стресс, защищая клетки от стресса, удаляя токсичные соединения, восстанавливая клеточный гомеостаз и, в некоторых случаях, восстанавливая нормальный рост. К ним относятся белки аквапорины, пролин, ферменты детоксикации, антифризные белки и протеины позднего эмбриогенеза (LEA) [6, 12, 13].

Продукты другой группы регулируют экспрессию генов и передачу сигнала в ответ на абиотический стресс. Предыдущие исследования, включая геномные исследования, показали, что различные транскрипционные регуляторные системы участвуют в индукции чувствительных к стрессу генов. DREB2 (Dehydration Responsive Element Binding 2) относится к семейству генов транскрипционных факторов, которые действуют как основной регулятор реакции растений на стресс. Из-за увеличения экспрессии как реакции на стрессовые условия этот ген может быть использован в качестве молекулярного маркера для идентификации засухоустойчивых растений [13].

Известно, что несколько групп цис и транс факторов вовлечены в транскрипцию, являющуюся ответом на стресс. Некоторые из них контролируются абсцизовой кислотой (ABA), а другие нет, что указывает на участие как ABA-зависимых, так и ABA-независимых регуляторных систем в регуляции экспрессии генов, чувствительных к стрессу. Одну и ту же группу генов могут вызывать различные виды стрессовых воздействий, таких как засуха и холод, что указывает на наличие перекрестных путей между сигнальными механизмами [14].

Связанные с патогенезом (PR) белки представляют собой группу разнообразных пептидов, накопление которых запускается патогенными атаками, абиотическим стрессом, гиперчувствительным ответом и системной приобретенной резистентностью. Они играют важную роль в естественной защите от вредителей и патогенов. PR-белки образуют точку пересечения для множества ответных сетей, реагируя с различными индукторами, такими как салициловая кислота, жасмоновая кислота, сестрин и этилен. Обнаруженные PR были детально изучены и в настоящее время сгруппированы в 17 семейств индуцибельных белков [15-17]. Классификация PR-белков основана на индуцированной экспрессии в ответ на инфекцию патогенными организмами: вирусами, бактериями или грибами в результате травмы или воздействия абиотического стресса [18-20].

Понимание молекулярных механизмов, которые регулируют реакцию на стресс и способствуют толерантности у культурных растений, открывает перспективы выбора перспективных генотипов и их модификации посредством генетических манипуляций [6].

В связи с этим актуальной задачей является выявление механизмов устойчивости для отбора перспективных генотипов древесных растений для дальнейшего размножения и вовлечения в селекционный процесс. Целью данной работы было выявление устойчивых к засухе генотипов березы и их гибридов на основе анализа экспрессии генов устойчивости к засухе.

Материал и методика исследований

Объектом исследования служили испытательные культуры березы (Betula L.) в возрасте 26 лет, произрастающие на территории Семилукского лесопитомника «ВНИИЛГИСбиотех». Испытательные культуры березы были выбраны для исследования засухоустойчивости, поскольку сохранилось семенное потомство (семьи), пережившие засухи 2010, 2013 годов, и, следовательно, имеющие адаптивную предрасположенность к высоким летним температурам. Происхождение образцов березы, подвергнутые стрессу, показано в таблице 1.

Листья березы для анализа засухоустойчивости были отобраны в третьей декаде июня 2019 года. По данным метеостанции Воронежской области, среднее количество осадков за апрель - июнь 2019 года было значительно ниже, чем среднегодовые значения за предыдущие 10 лет. В июне количество осадков было на 39,6 мм меньше среднегодового значения. В качестве контроля использовались листья растений березы, отобранные в оптимальный по температуре воздуха и осадкам период, наблюдаемый в середине июля.

 

Таблица 1

Происхождение образцов березы, подвергнутых стрессу в виде засухи

Образец

Инвентарный номер

Происхождение

1

261

11-9

Материнское дерево 11-9, береза повислая № 2, св-св

2

274

11-33

Материнское дерево 11-33, береза повислая № 1 (Беларусь), св-св

3

29-58

34-8

Материнское дерево 34-8, береза пушистая № 12, св-св

4

327

26-26

Материнское дерево 26-26, гибрид (Б-5хб.маньчжурская)

5

30-46

33-27

Материнское дерево 33-27, береза пушистая № 12, со-св

6

125в

35-4

Материнское дерево 35-4, береза пушистая № 17, со-св

7

233

26-27

Материнское дерево 26-27, гибрид (Б-4хб.вишневая)

8

348

7-23

Материнское дерево 7-23, береза повислая № 32, св-св

9

15-1

20-17

Материнское дерево 20-17, гибрид (Б-2хб.пушистая, смесь пыльцы)

10

264

9-11

Материнское дерево 9-11, гибрид (С-3 х б. бумажная)

Примечание: св – свободное опыление, со – самоопыление (однократный инбридинг), Б – береза пушистая, С – береза повислая

Источник: собственные разработки авторов

 

 

 

Выделение РНК

   Выделение РНК из образцов березы проводили модифицированным CTAB-методом [21]. CTAB-буфер для гомогенизации предварительно нагревали до 65° C на водяной бане. Навеска исследуемого материала была уменьшена до 200 мг. Гомогенизацию проводили в среде выделения (соотношение 1: 5), содержащей 2% CTAB, 2% PVP, 100 мМ Трис-HCl (рН 8,0), 25 мМ EDTA, 2 М NaCl, 2% β-меркаптоэтанол (добавляли при гомогенизации). Образцы инкубировали при 65° С, время инкубации увеличили до 30 минут, что способствовало связыванию фенольных компонентов и облегчало дальнейшую процедуру выделения. Затем к гомогенату добавляли равный объем смеси хлороформ: изоамиловый спирт (24: 1) и образцы центрифугировали при 10000 об/мин в течение 5 минут. Супернатант удаляли, повторно добавляли хлороформ: изоамиловый спирт (24: 1), центрифугировали при тех же параметрах. К отобранному супернатанту добавляли 12 М LiCl (1/2 объема образца) и инкубировали в течение 20 минут на льду. Далее проводили центрифугирование (10000 об/мин, 10 минут). Осадок растворяли в 300 мкл SDS-буфера (1 М NaCl, 0,5% SDS, 10 мМ HCl (pH 8,0)), 1 мМ EDTA (pH 8,0), добавляли равный объем смеси хлороформ: изоамиловый спирт (24: 1), центрифугировали в течение 10 минут при 10000 об/мин. Супернатант отбирали в новую пробирку, добавляли 3 объема 96% этанола. Образцы инкубировали при -20° С в течение 30 минут, затем центрифугировали (13000 об/мин, 10 минут). Супернатант удаляли, осадок просушивали и растворяли в 50 мкл деионизированной воды.

Качественная и количественная оценка образцов РНК

Качественную оценку суммарной РНК осуществляли с помощью электрофореза в 1% агарозном геле. Концентрацию РНК определяли на флюориметре Qubit 2.0 (Thermo Fisher Scientific, США) с использованием набора реактивов Qubit RNA BR Assay Kit (Thermo Fisher Scientific, США). В кювету для измерений добавляли 198 мкл буфера, 1 мкл интеркалирующего красителя и 1 мкл пробы, инкубировали в темноте 2 мин, затем проводили измерения концентрации.

Постановка обратной транскрипции

   Обратную транскрипцию проводили с помощью стандартного набора с MMLV-RH (Диаэм, Россия), используя 0,5-1 мкг суммарной РНК.

Подбор праймеров к генам устойчивости березы

Поиск генов стрессоустойчивости проводили c использованием литературных источников. Подбор праймеров к генам устойчивости образцов березы осуществляли на основе нуклеотидных последовательностей, представленных в международной базе данных NCBI. Праймеры к последовательностям генов стрессоустойчивости подбирали в программе Primer3. Данные олигонуклеотидные последовательности представлены в таблице 2.

 

Проведение ПЦР в реальном времени

Оптимизацию условий отжига праймеров проводили в градиенте температур (58-70°С) на амплификаторе C1000 (Bio-Rad, США). ПЦР-реалтайм проводили с использованием стандартного набора реагентов в присутствии красителя SYBR Green I (Синтол, Россия) с использованием CFX96 (Bio-Rad, США). Параметры реакции были следующими: 95°С – 3 минуты, затем 45 циклов из стадий 95°С – 10 с, 60°С – 30 с, 72°С – 30 с, затем финальная элонгация 72°С – 2 мин. В качестве референсного использовался ген GAPDH. Относительный уровень транскриптов определяли с использованием ΔΔCt-метода. Все эксперименты были проведены в трехкратной повторности.

 

Результаты и обсуждение

Экспрессию генов стрессоустойчивости pal, DREB2, PR-1, PR-10, lea8 провели у 10 подвергнутых воздействию засухи образцов березы. Анализ относительного уровня транскриптов гена pal показал увеличение данного показателя у опытных образцов 7 проанализированных генотипов (рис. 1).

Увеличение экспрессии гена pal способствует активации синтеза фермента фенилаланинаммонийлиазы, катализирующего первую реакцию фенилпропаноидного пути, которая продуцирует предшественники множества важнейших вторичных метаболитов, таких как таннины и антоцианы, способствующие формированию защиты растений в условиях воздействия абиотического и биотического стресса.

   Анализ экспрессии гена DREB2 показал увеличение данного показателя у всех проанализированных образцов березы кроме 348 (рис. 2).

Белки DREB2 относятся к семейству транскрипционных факторов, насчитывающему большое число представителей. Активация экспрессии гена DREB2 в ответ на воздействие абиотического стресса, такого как засуха и засоление было продемонстрировано у различных, в том числе и древесных (тополь), растений.

Семейство LEA первоначально было охарактеризовано как совокупность белков, аккумулирующееся в высоких концентрациях в зародышах на последних стадиях развития семени. Данные протеины значительно более гидратированы, чем большинство глобулярных белков, что может способствовать их участию в развитии защитных механизмов растений в условиях воздействия абиотического стресса. Увеличение экспрессии гена lea8 показано для образцов 29-58 и 15-1 (рис. 3).

 

 Таблица 2

Последовательности праймеров к генам стрессоустойчивости

Ген

Последовательность

1

pal

F: CTGTGGCTGCAACGGTTT

R: TCAATTTGAGGTCCGAGCCA

2

PR-10

F: GGCCCGGAACCATTAAGAAG

R: CCACCCTCGATCAAGCTGTA

3

PR-1

F: CCTCAAAGCCCACAATGACG

R: TCTCGTCCACCCATAGCTTC

4

lea8

F: AATGACTTTGACATGGGCGT

R: TATCCCAAACTGCAGAGCCA

5

GAPDH

F: CAGCCGAAGATGTCAATGCA

R: GGCCACTTGTTTGCTACCAA

6

DREB2

F: AGGCAGAGAACATGGGGAAA

R: GAAAGTTGAGGCGAGCGTAA

Источник: собственные разработки авторов

Рис. 1. Экспрессия гена pal у различных генотипов березы, подвергнутых воздействию засухи. Серые столбцы – опытные образцы, заштрихованные столбцы – контрольные образцы

Источник: собственные разработки авторов

 

 

Рис. 2. Экспрессия гена DREB2 у различных генотипов березы, подвергнутых воздействию засухи. Серые столбцы – опытные образцы, заштрихованные столбцы – контрольные образцы

Источник: собственные разработки авторов

 

Рис. 3. Экспрессия гена lea8 у различных генотипов березы, подвергнутых воздействию засухи. Серые столбцы – опытные образцы, заштрихованные столбцы – контрольные образцы

Источник: собственные разработки авторов

 

 

Экспрессия генов устойчивости к патогенезу PR-1 и PR-10 также значительно увеличилась у большинства проанализированных образцов, подверженных воздействию засухи. Относительный уровень транскриптов гена PR-1 образцов значительно возрос у образцов 233, 261, 264, 274, 348, 29-58 (рис. 4), гена PR-10 – у всех образцов кроме 327 и 15-1 (рис. 5).

 

 

 

Рис. 4. Экспрессия гена PR-1 у различных генотипов березы, подвергнутых воздействию засухи. Серые столбцы – опытные образцы, заштрихованные столбцы – контрольные образцы

Источник: собственные разработки авторов

 

Рис. 5. Экспрессия гена PR-10 у различных генотипов березы, подвергнутых воздействию засухи. Серые столбцы – опытные образцы, заштрихованные столбцы – контрольные образцы

Источник: собственные разработки авторов

 

 

Семейство связанных с патогенезом белков (PR-белков) играет важную роль в развитии защиты растительного организма в ответ на заражение патогенами. Также активация синтеза данных белков была показана в ответ на воздействие абиотического стресса, такого как воздействие засухи и высоких концентраций озона у древесных растений, в том числе, у березы.

Данные по оценке экспрессии стрессовых генов у 10 исследованных образцов березы свидетельствуют о развитии адаптационных механизмов в условиях воздействия засухи. Оценка разницы экспрессии у опытных и контрольных образцов показывает, что наибольшей адаптационной способностью обладает генотип 29-58 (табл. 3).

Все 5 маркеров стресса выявили наличие адаптационных механизмов у исследованных образцов перспективных генотипов березы, поэтому они могут быть рекомендованы для анализа стрессоустойчивости различных древесных видов растений.

Значительная адаптационная способность генотипа 29-58, выявленная на основе анализа экспрессии 5 генов засухоустойчивости, позволяет рекомендовать данный образец для введения в культуру in vitro с целью клонального микроразмножения и дальнейшего использования при лесовосстановлении и лесоразведении в лесостепной зоне Воронежской области.

Заключение

В результате воздействия засухи было обнаружено значительное увеличение экспрессии генов pal, PR-1, PR-10 и DREB2 в анализируемых образцах; в то же время были выявлены изменения экспрессии гена lea8 для двух из десяти генотипов. Наибольшее увеличение экспрессии для всех пяти генов показано для образцов березы 29-58 и 233, что указывает на развитие адаптивных механизмов у этих генотипов и может характеризовать их как наиболее стабильные. Выявленные перспективные генотипы древесных растений могут быть рекомендованы для дальнейшего размножения и вовлечения в селекционный процесс.

Работа выполнена в рамках государственного контракта на проведение научных исследований по теме «Применение постгеномных технологий для микроклонального размножения ценных генотипов древесных пород и ускоренного лесовосстановления и лесоразведения в лесостепной зоне Воронежской области».

 

Таблица 3

Значения разницы экспрессии генов засухоустойчивости образцов березы из опытной и контрольной групп

Наименование образца

Изменение показателя экспрессии, раз

pal

DREB2

lea8

PR-1

PR-10

233

17,5

20,6

1,2

14,0

46,0

261

1,5

10,7

0,8

5,3

15,6

264

2,2

10,2

1,1

3,7

19,4

274

3,0

19,5

0,8

4,0

7,8

30-46

6,6

4,9

1,1

0,7

6,0

327

3,4

5,9

0,8

0,5

1,1

348

0,7

0,8

0,9

3,2

5,7

29-58

14,2

244,4

3,8

100,2

188,2

125в

1,0

 

2,1

1,2

1,2

1,56

15-1

0,8

3,0

1,8

1,0

 

1,0

 

Стрелками ↑ (увеличение) и ↓ (снижение) обозначено изменение экспрессии у исследуемых образцов

 Источник: собственные разработки авторов

Список литературы

1. Physiological Plant Ecology, 4th ed. / W. Larcher // Springer Science & Business Media. – 2003. –254 p. – doi: 10.1007/978-3-642-96545-6.

2. Krasensky, J. Drought, salt, and temperature stress-induced metabolic rearrangements and regulatory networks / J. Krasensky, C. Jonak // Journal of experimental botany. – 2012. – Vol. 63. – №. 4. – P. 1593-1608. – doi: 10.1093/jxb/err460.

3. Bartels, D. Drought and salt tolerance in plants / D. Bartels, R. Sunkar // Critical reviews in plant sciences. – 2005 – Vol. 24. – №. 1. – P. 23-58. – doi: 10.1080/07352680590910410.

4. Valliyodan, B. Understanding regulatory networks and engineering for enhanced drought tolerance in plants / B. Valliyodan, H. T. Nguyen // Current opinion in plant biology – 2006. – Vol. 9. – №. 2. – P. 189-195. – doi: 10.1016/j.pbi.2006.01.019.

5. Cold stress and acclimation – what is important for metabolic adjustment? / A. Janská, P. Maršík, S. Zelenková // Plant Biology. – 2010. – Vol. 12. – №. 3. – P. 395-405. – doi: 10.1111/j.1438-8677.2009.00299.x.

6. Shinozaki, K. Gene networks involved in drought stress response and tolerance / K. Shinozaki, K. Yamaguchi-Shinozaki // Journal of experimental botany. – 2007. – Vol. 58. – №. 2. – P. 221-227. – doi: 10.1093/jxb/erl164.

7. Kumar, S. G. NaCl effects on proline metabolism in two high yielding genotypes of mulberry (Morus alba L.) with contrasting salt tolerance / S. G. Kumar, A. M. Reddy, C. Sudhakar // Plant Science. – 2003. – Vol. 165. – №. 6. – P. 1245-1251. – doi: 10.1016/s0168-9452(03)00332-7.

8. Differential response of NADP-dehydrogenases and carbon metabolism in leaves and roots of two durum wheat (Triticum durum Desf.) cultivars (Karim and Azizi) with different sensitivities to salt stress / D. Bouthour, T. Kalai, H. Chaffei, H. Gouia, F. Corpas // Journal of plant physiology. – 2015. – Vol. 179. – P. 56-63. – doi: 10.1016/j.jplph.2015.02.009.

9. Chinnusamy, V. Cold stress regulation of gene expression in plants / V. Chinnusamy, J. Zhu, J. K. Zhu // Trends in plant science. – 2007. – Vol. 12. – №. 10. – P. 444-451. – doi: 10.1016/j.tplants.2007.07.002.

10. Transgenerational epigenetic inheritance in plants / H. Hauser, W. Aufsatz, C. Jonak, C. Luschnig // Biochimica et Biophysica Acta (BBA)-Gene Regulatory Mechanisms. – 2011. – Vol. 1809. – №. 8. – P. 459-468.

11. Khraiwesh, B. Role of miRNAs and siRNAs in biotic and abiotic stress responses of plants / B. Khraiwesh, J. K. Zhu, J. Zhu // Biochimica et Biophysica Acta (BBA)-Gene Regulatory Mechanisms. – 2012. – Vol. 1819. – №. 2. – P. 137-148. – doi: 10.1016/j.bbagrm.2011.05.001.

12. Jan, A. T. Plant abiotic stress: deciphering remedial strategies for emerging problem / A. T. Jan, P. Singhal, Q. M. R. Haq // Journal of Plant Interactions. – 2013. – Vol. 8. – №. 2. – P. 97-108. – doi: 10.1080/17429145.2012.702226.

13. Rini, D. W. I. S. Sequence variation of DREB2 gene as a potential molecular marker for identifying resistant plants toward drought stress / D. W. I. S. Rini // Nusantara Bioscience. – 2019. – Vol. 11. – №. 1. – P. 35-43. – doi: 10.13057/nusbiosci/n110107.

14. Shinozaki, K. Regulatory network of gene expression in the drought and cold stress responses / K. Shinozaki, K. Yamaguchi-Shinozaki, M. Seki // Current opinion in plant biology. – 2003. – Vol. 6. – №. 5. – P. 410-417. – doi: 10.1016/s1369-5266(03)00092-x.

15. Edreva, A. Pathogenesis-related proteins: research progress in the last 15 years / A. Edreva // Gen Appl Plant Physiol. – 2005. – Vol. 31. – №. 1-2. – P. 105-24. – doi: 10.1093/jxb/41.6.701.

16. Van Loon, L. C. Significance of inducible defense-related proteins in infected plants / L. C. Van Loon, M. Rep, C. M. J. Pieterse // Annu. Rev. Phytopathol. – 2006. – Vol. 44. – P. 135-162. – doi: 10.1146/annurev.phyto.44.070505.143425.

17. Veluthakkal, R. Pathogenesis-related genes and proteins in forest tree species / R. Veluthakkal, M. G. Dasgupta // Trees. – 2010. – Vol. 24. – №. 6. – P. 993-1006. – doi: 10.1007/s00468-010-0489-7.

18. Characterization of PR-10 genes from eight Betula species and detection of Bet v 1 isoforms in birch pollen / M. Schenk, J. Cordewener, A. America, W. Westende, M. Smulders, L. Gilissen // BMC plant biology. – 2009. – Vol. 9. – №. 1. – P. 24. – doi: 10.1186/1471-2229-9-24.

19. The transcriptional response of hybrid poplar (Populus trichocarpa x P. deltoids) to infection by Melampsora medusae leaf rust involves induction of flavonoid pathway genes leading to the accumulation of proanthocyanidins / M. Miranda, S. Ralph, R. Mellway, R. White, M. Heath, J. Bohlmann, C. Constabel // Molecular Plant-Microbe Interactions. – 2007. – Vol. 20. – №. 7. – P. 816-831. – doi: 10.1094/mpmi-20-7-0816.

20. Poplar and pathogen interactions: insights from Populus genome-wide analyses of resistance and defense gene families and gene expression profiling / S. Duplessis, I. Major, F. Martin, A. Séguin // Critical Reviews in Plant Science. – 2009. – Vol. 28. – №. 5. – P. 309-334. – doi: 10.1080/07352680903241063.

21. Chang, S. A simple and efficient method for isolating RNA from pine trees / S. Chang, J. Puryear, J. Cairney // Plant molecular biology reporter. – 1993. – Vol. 11. – №. 2. – P. 113-116. – doi: 10.1007/bf02670468.