MOLECULAR-GENETIC ANALYSIS OF PROPAGATED IN VITRO CLONES OF POPULUS ALBA L. AND POPULUS TREMULA L. USING MICROSATELLITE MARKERS
Abstract and keywords
Abstract (English):
Use of planting material of forest trees with improved hereditary characteristics is one of the ways to increase the productivity and biological stability of forest stands. It requires taking measures to develop and improve selection base using modern approaches and methods of genetics and biotechnology. A molecular genetics assessment of clone plants of aspen (Populus tremula L.) and white poplar (Populus alba L.) from a long-term in vitro collection (up to 24 years), planted in a greenhouse and field conditions (nursery), was carried out. SSR loci of the PTR series (PTR5, PTR7, PTR8, PTR12, PTR14) were used as DNA markers. Evaluation of clones' ploidy was carried out on the basis of the diagnosis of "loss of heterozygosity" (LOH) effect. Analysis of 5 microsatellite loci of the specimens showed their high intraclonal genotypic stability and homogeneity in vitro and ex vitro. For the first time, data on the results of a comparative determination of ploidy using karyological and microsatellite analysis were presented. Based on the results of the SSR analysis, it can be concluded that the structure of molecular markers is stable among the samples of one clone that are in long-term cultivation. The ratio of the representation (dose) of electrophoretic variants of PCR products serves as an indirect sign of determining ploidy, but for its reliable assessment it is necessary to study the number of loci that are three times larger than the main set of chromosomes. The specimen also requires information on the amplification coefficient of the markers under study. Thus, it is necessary to use both chromosomal and microsatellite analyzes for reliable assessment of intraclonal homogeneity of various specimens, the development of understanding of clone genotypes formation and determination of their ploidy

Keywords:
Populus alba L., Populus tremula L., in vitro cultivation, microsatellite analysis, genetic certification, ploidy
Text
Publication text (PDF): Read Download

Введение

Среди широкого разнообразия древесных растений, используемых для создания плантаций с коротким циклом ротации, в условиях климата умеренных широт предпочтение отдается, как правило, видам и гибридам рода Тополь (Populus L.), что обусловлено рядом преимуществ с точки зрения лесоводственных и экономических аспектов искусственного культивирования данной породы [1-3, 11, 16].

К настоящему времени получено и используется при плантационном лесовыращивании значительное количество сортов и гибридов Populus, характеризующихся высокой продуктивностью древесного сырья и его качеством. При этом особый интерес представляют триплоидные экземпляры (3n = 57), зачастую проявляющие гетерозис по признаку скорости роста, накопления биомассы и устойчивости к сердцевинным гнилям.

Кроме прямого лесопромышленного использования, тополя представляют собой ценный объект для проведения биологических исследований, являясь, в частности, модельным растением для изучения различных генетических и селекционных аспектов, связанных с древесными породами. Так, например, тополь – первое древесное растение (и третий растительный объект после арабидопсиса и риса) для которого было выполнено полное секвенирование генома (вид P. trichocarpa) [14].

Размножение тополей для целей плантационного лесовыращивания, как правило, производят вегетативным способом, путем черенкования. В то же время многие ценные быстрорастущие и продуктивные формы (в частности, тополя белого (Р. alba L.) и осины (P. tremula L.)) относятся к трудночеренкуемым, что ограничивает их использование для закладки искусственных древостоев.

Эффективным способом вегетативного размножения ценных генотипов лесных древесных растений и получения качественного однородного посадочного материала является клональное микроразмножение (клонирование в условиях in vitro). Однако в процессе культивирования in vitro у растений-регенерантов может наблюдаться возникновение нежелательных наследственных аномалий, среди которых сомаклональная изменчивость играет ведущую роль. В отличие от точечных генных мутаций, сомаклональная изменчивость, как правило, представляет собой хромосомные или геномные аберрации, отличается большей частотой возникновения и комплексностью изменений [12]. Согласно современным литературным данным, сомаклональная изменчивость также может иметь эпигенетическую природу и характеризоваться фенотипическим проявлением на организменном, клеточном и субклеточном уровнях [4, 7, 12, 15, 24].

Потенциальным фактором, определяющим возникновение сомаклональной изменчивости, является интенсификация процессов деления, роста и развития растительных клеток в условиях in vitro, что делает уязвимым их наследственный аппарат к различному роду нарушений. Среди условий, способствующих формированию сомаклональной изменчивости, можно отметить использование регуляторов роста, осуществление морфогенеза растений через каллусные культуры, увеличение времени культивирования и др. [4, 12].

Одним из способов контроля возникновения сомаклональных вариантов является проведение мониторинга состояния культур in vitro с использованием морфологических, цитологических, кариологических и молекулярно-генетических методов. В то же время применение молекулярно-генетических технологий может иметь свои ограничения. Так, проведение анализа на основе SNP-маркирования для идентификации аномальных растений, как правило, является низкоэффективным, что, как указывалось выше, обусловлено надгенным уровнем происходящих изменений. Для эффективного решения данной задачи наиболее оптимальным способом являются молекулярно-генетические подходы, описывающие хромосомные или геномные аберрации [18].

За последнее десятилетие использование ДНК-маркеров для характеристики хромосомных аберраций приобрело определенную значимость. В качестве примера можно привести применение кодоминантных RFLP- и SSR- (микросателлитных) маркеров для выявления кариологических нарушений на основании диагностики эффекта «потери гетерозиготности» (ПГ, или LOH (англ.)). В качестве RFLP-локусов используются непосредственно фрагменты самих генов (EST), SSR-маркеров – внутренние повторы в генах (EST-SSR) или сцепленные с генами микросателлитные локусы. Преимуществом последнего типа маркеров является значительная разрешающая сила анализа, определяемая высоким уровнем изменчивости. Кроме того, генотипирование SSR-локусов позволяет оценить и уровень мутабельности в изучаемых растительных тканях путем выявления эффекта «микросателлитной нестабильности» (МН, или MI (англ.)). Для анализа микросателлитных локусов на современном этапе используют автоматизированные генетические анализаторы, характеризующиеся высокой чувствительностью детекции исследуемых молекул ДНК и стандартизированными условиями электрофоретического фракционирования [6, 8].

К настоящему времени ФГБУ «ВНИИЛГИСбиотех» разработаны методы клонального микроразмножения и длительного хранения (до 25 лет) микрорастений тополей (включая осину) в коллекции in vitro, созданы опытные плантационные культуры видов и гибридов Populus [19, 20]. Для предотвращения возникновения наследственных аномалий разработаны методики, предполагающие проведение регенерации растений на основе прямого морфогенеза при использовании безгормональных питательных сред. В то же время вопросы, связанные с длительным сроком поддержания коллекций растительных тканей в условиях in vitro, а также генетическая нестабильность исходного биологического материала как факторы, способствующие возникновению сомаклональной изменчивости, до настоящего момента остаются не решенными в полной мере.

Среди имеющейся коллекции асептических культур ФГБУ «ВНИИЛГИСбиотех» особый интерес представляют триплоидные формы тополя белого и осины, что, с одной стороны, обусловлено их практической значимостью (повышенная биологическая продуктивность и устойчивость к неблагоприятным факторам среды). С другой стороны, вследствие наличия миксоплоидной структуры тканей данных клонов, коллекции культур являются удобным модельным объектом для изучения геномных изменений, которые могут возникать в ходе длительного хранения в условиях in vitro.

Исходя из всего вышесказанного, целью данных исследований являлся молекулярно-генетический анализ микроразмноженных клонов P. alba и P. tremula на основе использования микросателлитных маркеров для определения статуса плоидности в условиях in vitro и ex vitro.

Материал и методы

Объекты исследования

В качестве материала для исследований были использованы образцы молодых листьев размноженных in vitro клонов осины (P. tremula L. – № 15/01 и № 6/3) и тополя белого (P. alba – клон E). Образцы клонов осины и тополя были заготовлены от растений, находящихся в коллекции in vitro (длительность культивирования до 24 лет), высаженных в теплицу и полевые условия (Семилукский лесопитомник Воронежской обл.). Возраст микроразмноженных растений, находящихся в теплице, составлял 3 года, а в питомнике (полевые условия) – 17 лет (осина) и 21 год (тополь).

Исходные деревья осины (№ 15/01 и 6/3) были отобраны В.П. Петрухновым по продуктивности и устойчивости к гнили [22]. Быстрорастущий аутотриплоидный гибрид № 101/83 тополя белого (клон Е) получен О.С. Машкиной при использовании в гибридизации искусственно синтезированной с помощью повышенной температуры нередуцированной диплоидной (2n) пыльцы [5, 19].

Методы исследования

Экстракцию ДНК осуществляли CTAB-методом [23], модификация которого заключалась в добавлении 5-7 % поливинилпирролидона к среде выделения на стадии гомогенизации для избавления от фенольных примесей, в большом количестве присутствующих в образцах древесных растений. Полимеразную цепную реакцию (ПЦР) проводили на основании использования HF (Taq/Pfu) ДНК-полимеразы (Праймтех, Беларусь) по следующему алгоритму: 94 °С – 3 мин (1 цикл), затем 40 циклов из стадий 94 °С – 20 с, 55 °С – 20 с, 72 °С – 20 с. В качестве ДНК-маркеров были использованы SSR-локусы серии PTR, представленные в табл. 1 [9].

Разделение ПЦР-продуктов исследуемых образцов и определение размера анализируемых нуклеотидных последовательностей осуществляли методом капиллярного электрофореза с помощью генетического анализатора ABI Prism 310 (Applied Biosystems, США). Электрофореграммы образцов визуализировали в программе «Data collection v. 1.3» (Applied Biosystems, США). Типирование размеров фрагментов ДНК проводили в программе «Gene Mapper v. 4.0» (Applied Biosystems, США).

 

 

Таблица 1

Характеристика микросателлитных маркеров, использованных в анализе образцов тополя и осины

Table 1

Characterization of microsatellite markers used in the analysis of poplar and aspen samples

SSR–маркер | SSR-marker

Повтор | Repeat

Последовательность праймера (5’→3’) | Primer sequence (5 '→ 3')

PTR5

(TG)7

CTTCTCGAGTATAAATATAAAACACCA (F)

TCACATCACCCTCTCAGTTTCGC (R)

PTR7

(CT)5AT(CT)6

ATTTGATGCCTCTTCCTTCCAGT (F)

TATTTTCATTTTCCCTTTGCTTT (R)

PTR8

(A)11(CT)8

TAGGCTAGCAGCTACTACAGTAACA (F)

TTAAGTGCGCGTATCCCAAAGA (R)

PTR12

(AAAG)3A6n7(AAAG)2

AATAACCATCCCTCCAATAACCTAC (F)

TATTTTGCACCTAAATGGCTGTTCT (R)

PTR14

(TGG)5

TCCGTTTTTGCATCTCAAGAATCAC (F)

ATACTCGCTTTATAACACCATTGTC (R)

Материалы для таблицы взяты из источника [9]

Source: [9]

 

 

Анализ плоидности проводили на основании исследования полученных микросателлитных спектров образцов [17]. Расчет доли генотипической гетерогенности для образцов, относящихся к одному и тому же клону, осуществляли на основании анализа эффекта «потери гетерозиготности». Суть метода заключается в оценке значений концентрации продуктов, полученных от амплификации одного локуса у нескольких образцов с одним генотипом. В анализе используются только гетерозиготные локусы, то есть показавшие наличие двух и более аллелей. При этом производится сравнение высоты пиков на электрофореграммах соответствующей концентрации продуктов. Выборка полученных значений анализируется для каждого локуса путем расчета медианы и определения минимального и максимального отклонения измеренных параметров от данного значения. Для установления аллельного дисбаланса, характеризующего степень различия между образцами одного генотипа, производится расчет коэффициента соотношения титра аллелей (AR) по вычислению отношения численных значений, равных максимальной концентрации продуктов амплификации для каждого аллеля, выражающихся пиками на электрофореграммах:

                                                                                                 AR=AxAy ,                                                                                                                                                                                                                                                                  Уравнение 1

где AR – коэффициент соотношения титра аллелей (allele ratio);

Ax – высота пика (титр) аллеля Х на фореграмме;

Ay – высота пика (титр) аллеля Y на фореграмме.

Коэффициент аллельного дисбаланса рассчитывается по отношению коэффициентов соотношения титра аллелей (AR) для выборки образцов с одинаковым генотипом:

                                                                                                 AI=ARiARk ,                                                                                                                                                                                                                                          Уравнение 2

где AI – коэффициент аллельного дисбаланса;

ARi – коэффициент соотношения титра аллелей для образца I;

ARk – коэффициент соотношения титра аллелей для образца K.

 

В случае 0,67 < AI < 1,35 различия между образцами по данному локусу определяются значимыми и обусловлены анеуплоидией или гетероплоидией.

Значения генотипической гетерогенности образцов одного клона рассчитывались путем нахождения медианы для выборки значений коэффициентов аллельного дисбаланса и расчета максимального и минимального отклонений от нее, которые выражались в процентах.

Следует отметить, что коэффициент аллельного дисбаланса не оказывает влияния на коэффициент амплификации аллельных вариантов при условии унификации условий ПЦР-амплификации образцов ДНК.

Результаты

Проведенный предварительный анализ электрофоретических профилей растительного материала осины и тополя выявил наличие трех типов мультимаркерных спектров, что соответствует аналогичному числу генотипов, относящихся к клонам 15/01, 6/3 и Е.

Исходя из того, что для установления генотипа индивида необходимо проведение анализа расщепления в потомстве или исследование гамет, результатом интерпретации данных электрофоретического фракционирования явилось составление не генетических паспортов, а генетических формул клонов (табл. 2).

Согласно ранее проведенным исследованиям, PTR микросателлитные маркеры успешно применяются для различения генотипов внутри различных видов тополей [13]. Детальный анализ генетических формул (табл. 2) рамет 15/01 и Е показал их идентичность в пределах клонов, что свидетельствует об их едином происхождении и отсутствии мутационных событий в ходе культивирования in vitro применительно к изученным локусам. В то же время, по данным Rahman и Rajora [10], генетическая неоднородность и сомаклональная изменчивость клонов осины может возникать и при микроразмноженнии растений через вегетативные почки, т.е. минуя этап каллусообразования. Полученные нами данные показывают отсутствие микросателлитной нестабильности по изученным локусам, что может свидетельствовать о сохранении внутриклоновой генетической однородности как в условиях in vitro (в процессе длительного культивирования), так и ex vitro (при высадке растений в грунт).

На следующем этапе исследований был проведен сравнительный анализ плоидности растительных образцов с использованием данных предварительной кариологической оценки и результатов молекулярно-генетического анализа [21]. Согласно ранее проведенным исследованиям, размноженные in vitro клоны 15/01 (осина) и Е (тополь) являются триплоидными (2n = 57), а клон 6/3 (осина) – диплоидным (2n = 38) (рис. 2).

 

ck_FlEWRk8s.jpg

1) клон 15/01, 2) клон 6/3, 3) клон «Тополь Е»

Рисунок 1. Электрофореграмма ПЦР-ампликонов локусов PTR14 и PTR12 образцов осины (1, 2) и тополя (3)

Figure 1. Electrophoregram of PCR amplicons of the PTR14 and PTR12 loci of aspen (1, 2) and poplar (3) samples

Источник: собственные фотографии авторов

Source: authorspictures

Таблица 2

Генетические формулы клонов осины и тополя, полученные в ходе SSR-анализа

Table 2

Genetic formulas of aspen and poplar clones obtained by SSR analysis

Образца | Sample no.

Источник | Source

Локус, размер продукта (п.н.) | Locus, product size (bp)

PTR8

PTR7

PTR5

PTR14

PTR12

Осина 15/01 | Aspen 15/01

исходное

дерево

140

230/238

254

197/200

256

in vitro

140

230/238

254

197/200

256

теплица

140

230/238

254

197/200

256

полевые условия

140

230/238

254

197/200

256

Осина 6/3 | Aspen 6/3

полевые условия

130

243/251

247/253

197/203

256/265

Тополь Е | Poplar E

in vitro

134

221/247

253

197/199/203

254/256

теплица

134

221/247

253

197/199/203

254/256

Источник: собственные вычисления авторов

Source: own calculations

 

Безымянный.tif

Рисунок 2. Метафазные пластинки размноженных in vitro клонов осины 15/01 (1, 2), 6/3 (3)

и клона тополя Е (4): 1) 2n = 3х =57 (модальное), 2) 2n = 2х = 38, 3) 2n = 2х = 38, 4) 2n = 3х = 57

Figure 2. Metaphase plates of aspen 15/01 (1, 2), 6/3 (3) clones propagated in vitro and of poplar clone E (4):

1) 2n = 3x = 57 (modal), 2) 2n = 2x = 38, 3) 2n = 2x = 38, 4) 2n = 3x = 57

Источник: Собственные фотографии авторов

Source: autors pictures

Таблица 3

Плоидность и уровень миксоплоидии размноженных in vitro клонов осины и тополя по данным

кариологического анализа

Table 3

Ploidy and level of mixoploidy of aspen and poplar clones propagated in vitro according to karyological analysis

Клон | Clone

Доля клеток с числом хромосом, % | The proportion of cells with the number of chromosomes,%

Уровень миксоплоидии, % | Mixoploidy level,%

2n = 2х = 38

2n = 3х = 57

анеуплоидные

Осина 15/01 | Aspen 15/01

32,7

63,7

3,6

36,3

Осина 6/3 | Aspen 6/3

85,0

15,0

15,0

Тополь Е | Poplar E

12,2

84,8

3,0

15,2

Источник: собственные вычисления авторов

Source: own calculations

 

 

Также следует отметить, что по данным хромосомного анализа клон триплоидной осины 15/01 имеет выраженную миксоплоидную природу триплоид-диплоидного типа. Клетки с модальным триплоидным числом хромосом (2n = 57) у него составили 63,7 %, диплоидным (2n = 38) – 32,7 % и анеуплоидным – 3,6 %. Уровень миксоплоидии (процент клеток с числом хромосом, отклоняющимся от модального) составил 36,3 %. У двух других клонов (6/3 и Е) он был в 2 раза ниже (15 %) (табл. 3).

В ходе проведенного микросателлитного анализа с использованием пяти SSR-маркеров для образцов генотипа, обозначенного как клон «Тополь Е», были выявлены три типа электрофоретических спектров: однофракционные (локусы PTR5, PTR8), двухфракционные (локусы PTR7, PTR12) и трехфракционные (локус PTR14) (рис. 1). Для образцов осины клона 6/3 были типированы двухфракционные (локусы PTR5, PTR7, PTR12, PTR14) и однофракционные (локус PTR8) спектры. Аналогичные результаты были получены для образов клона 15/01 осины: один электрофоретический вариант (локусы PTR5, PTR8, PTR12) и два электрофоретических варианта (локусы PTR7, PTR14).

Согласно общепринятым постулатам молекулярной генетики, электрофоретические профили генотипов, содержащих три набора хромосом, при анализе отдельных локусов могут быть представлены одной (генотип АxАxАx или Аx00), двумя (генотип АxАxАy или АxАy0) или тремя (генотип АxАyАz) фракциями. В случае диплоидных тканей выявляются, как правило, однофракционные (генотип АxАx или Аx0) или двухфракционные (генотип АxАy) SSR-спектры. Таким образом, интерпретация электрофоретических данных, полученных для микросателлитных локусов клона Е тополя, указывает на триплоидность его генома, что полностью согласуется с результатами кариологического анализа. Также следует отметить, что трехаллельный спектр генотипа указывает на его наиболее вероятностное происхождение путем гибридизации генотипов (или гамет) с различным уровнем плоидности, а не появление вследствие эндогенных нарушений, произошедших в соматических клетках, поскольку возникновение и закрепление мутации представляет собой значительно более редкий процесс по сравнению с гибридизационным механизмом. Кроме того, косвенным подтверждением триплоидного характера соматических клеток клона «Тополь Е» являются особенности двухфракционных спектров локусов PTR7 и PTR12, выражающиеся в неравной количественной представленности вариантов – в соотношении ≈ 2:1, что соответствует генотипу АxАxАy.

Проведенный анализ электрофоретических спектров SSR-локусов клона 6/3 показал, что они являются одно- или двухфракционными. В большинстве случаев соотношение высот пиков изученных двухфракционных локусов было относительно равным. На основании совокупности полученных результатов анализа клон 6/3 был отнесен к диплоидному типу, что согласуется с данными хромосомного анализа.

Отсутствие трехфракционных спектров у клона осины 15/01 в спектрах пяти SSR-маркеров может как отражать его диплоидную природу, так и быть связанным с ограниченным числом изученных локусов, определяющим более низкую вероятность выявления всего спектра аллельной изменчивости молекулярно-генетических маркеров. Кроме того, происхождение генотипов путем возникновения геномных аберраций в соматических тканях или получения за счет самоопыления материнского растения аберрантной диплоидной пыльцой делает невозможным типирование плоидности получаемых генотипов на основании учета числа детектируемых электрофоретических вариантов в спектрах, что связано с сохранением числа аллелей и типов аллелей, несмотря на изменение структуры генотипа.

Одним из косвенных признаков, определяющих отнесение образцов к диплоидным или триплоидным генотипам, является соотношение представленности (дозы) электрофоретических вариантов. Как правило, доминирующий тип полиморфизма SSR-маркеров связан с варьированием длины тандемных повторов и относительно небольшими различиями в размерах вариантов, что в целом не отражается на эффективности их амплификации (коэффициент амплификации = const), и на электрофореграммах такие алломорфы представлены относительно равными по высоте пиками (AI = 1). В то же время аллельные варианты, характеризующиеся полиморфизмом в области отжига праймеров, на первых этапах ПЦР (при посадке олигонуклеотидов на ДНК-матрицу) имеют неодинаковые коэффициенты амплификации, что выражается на электрофореграммах в превалировании (по высоте пика) одного из алломорфов. В случае если различия в коэффициенте амплификации наблюдаются и на экспоненциальной фазе ПЦР, то дисбаланс между соотношением пиков алломорфов будет увеличиваться после каждого цикла ПЦР и может достигать 10-кратных значений (0,1←AI→10).

Таким образом, отсутствие детальной информации о кинетических характеристиках ПЦР-амплификации каждого из вариантов делает данный признак неабсолютным диагностическим критерием. Дополнительным моментом, усложняющим диагностику базового уровня плоидности на основании анализа показателя AI, является анализ химерных индивидов. Так, значение параметра AI среди различных рамет клона 15/01 не являлось постоянным и варьировало для локусов с двухфракционными спектрами в пределах 1,08–1,48 (PTR7) и 1,33–2,64 (PTR14), что соответствует соотношениям аллельных вариантов от 1:1 (диплоид) до 2:1 (триплоид).

На основании полученных результатов варьирования показателя AI среди рамет клонов осины и тополя задачей следующего этапа работы явилась оценка генотипической гетерогенности растительного материала. Данные исследования были проведены только для клона осины 15/01 и тополя Е, что связано с наличием рамет из разных мест культивирования.

Так, по локусу PTR7 для тканей в культуре in vitro и на стадии адаптации в условиях ex vitro степень дисбаланса между алломорфами была низкой и не превышала 8 %. В то же время в образцах листьев взрослого исходного дерева она достигала 36 %, а у рамет на плантациях – 48 %. Соотношение величины пиков для локуса PTR14 составляло от 1:1,33 (растения на стадии адаптации ex vitro) до 1:2,07 (исходное материнское дерево). Значение показателя генотипической гетерогенности среди образцов варьировало от 1,2 % до 38,6 % (в среднем 14,6 %) для локуса PTR7 и от 1,0 % до 56 % (в среднем 21,7 %) для локуса PTR14 (табл. 4). Данные значения указывают на вероятную модель формирования генотипической структуры рамет в результате сочетания клеток с различной плоидностью – т.е. миксоплоидную природу клона.

Для рамет тополя Е значение параметра генотипической гетерогенности было выше и составило в среднем 31 % (PTR7 – 42,6 %, PTR12 – 42,8 % и PTR14 – 7,7 % (табл. 4). Исходя из того, что указанные локусы локализованы в различных группах сцепления, полученные результаты указывают на избирательный характер геномных аберраций, ассоциированных с определенными хромосомами.

Обсуждение

Отсутствие изменений в спектрах микросателлитных продуктов подтверждает результаты ранее проведенных сравнительных исследований размноженных in vitro клонов различных гибридов тополя белого и осины 15/01 и 6/3 с их материнскими формами по 12 микросателлитным локусам [21]. В целом проведенные исследования позволили не только выполнить молекулярно-генетическую паспортизацию и изучить генетическую стабильность клонов осины и тополя в условиях in vivo, in vitro и ex vitro, но провести сравнительный анализ двух подходов к оценке уровня плоидности биологических объектов. Идентификация полиплоидных тополей, искусственно созданных путем химической или физической обработки, с помощью SSR-маркеров может быть затруднена из-за отсутствия вариаций в неоаллелях. Естественные гибриды формируются путем длительной эволюции, что позволяет успешно их генотипировать молекулярными методами анализа. Полученные в нашей работе результаты анализа микросателлитных локусов подтверждаются данными хромосомного анализа для всех исследованных генотипов.

 

Таблица 4

Значения генотипической гетерогенности для генотипов осины и тополя

Table 4

Values of genotypic heterogeneity for genotypes of aspen and poplar

Параметр | Parameter

Генотип | Genotype

Локус | Locus

Средняя, % |

Average,%

PTR8

PTR7

PTR5

PTR12

PTR14

Уровень генотипической гетерогенности, среднее значение, % | Level of genotypic heterogeneity, mean value,%

Осина 15/01 | Aspen 15/01

14,6±0,73

21,7±1,08

19,0±0,95

Тополь Е | Poplar E

42,6±2,13

42,8±2,14

7,7±0,38

31,0±1,55

Источник: собственные вычисления авторов

Source: own calculations

 

На основании полученных результатов были сформулированы основные методологические аспекты, учитывающие специфику молекулярных и кариологических маркеров и определяющие применимость их для анализа общих и частных вопросов цитогенетики:

1. Объектом цитологических исследований является непосредственно кариотип клетки целиком. В то же время при молекулярно-генетическом подходе анализируется отдельная хромосома, маркированная SSR-локусом.

2. При цитологических исследованиях лиственных древесных видов хромосомы не типируются, а подсчитывается их общее число. В данном случае многие аспекты, связанные с аномалиями распределения отдельных хромосом, могут не учитываться. При молекулярно-генетическом анализе изучаются хромосомы по отдельности, а общий результат выводится путем синтеза одиночных данных.

3. Количество используемых SSR-маркеров является ограниченным, что связано со стоимостью проведения анализа. Статистически достоверным является использование в ходе исследований количества локусов, трехкратно превышающего число основного набора хромосом.

4. Недостатком цитологического подхода является тот факт, что уровень плоидности можно измерять только для тканей, находящихся в состоянии митоза или мейоза. В случае молекулярно-генетического метода анализируется вся совокупность клеток и тканей, находящихся в данном образце.

5. Среди методологических сложностей молекулярно-генетического метода выделяется необходимость наличия аллельного разнообразия, наличие информации о характеристиках кинетики ПЦР-амплификации для различных аллелей, использование в анализе референсных стандартов, наличие полной депротеинизации ДНК-матриц и пр.

При расчете коэффициента генетической гетерогенности необходимо использовать результаты анализа ПЦР-спектров, полученных при сходных условиях амплификации (при равном коэффициенте амплификации). Получаемые данные показывают различия по относительному числу клеток, характеризующихся гетероплоидией применительно к конкретной хромосоме. В случае аллелей с одинаковым коэффициентом амплификации уже сам дисбаланс меду высотами пиков свидетельствует об уровне миксоплоидии (соотношения гетероплоидных и нормальных) применительно к конкретной маркированной хромосоме. При сравнении двух разных образцов (без наличия информации о коэффициенте амплификации) параметр генотипической гетерогенности указывает относительные различия между образцами по долевому содержанию гетероплоидных клеток. При этом определить, какой образец является нормой (стандартом) по уровню плоидности, не представляется возможным без дополнительной оценки кинетических процессов ПЦР-амплификации.

Таким образом, анализ количества и размера ПЦР-продуктов, полученных в ходе исследования микросателлитных локусов, позволяет сделать вывод о стабильности структуры молекулярных маркеров среди образцов одного клона, находящихся в условиях длительного культивирования. Однако для достоверного определения уровня плоидности методом микросателлитного анализа необходимо изучить количество локусов, трехкратно превышающих по числу основной набор хромосом образца, что является дорогостоящим и трудоемким для реализации. Соотношение представленности (дозы) электрофоретических вариантов по микросателлитным локусам не является абсолютным критерием определения плоидности при отсутствии информации о кинетических характеристиках ПЦР-амплификации. В то же время микросателлитный анализ дает возможность провести оценку генотипов по отдельным хромосомам и для всей совокупности клеток образца, в отличие от хромосомного анализа, где оценка ведется по отдельным клеткам исследуемой ткани. Анализ электрофоретических спектров микросателлитных локусов позволяет сформировать представление о возможном механизме образования генотипов. В связи с этим, для достоверной оценки внутриклоновой однородности различных образцов, формирования представления об образовании генотипов исследуемых клонов и определения их плоидности необходимо использование как хромосомного, так и микросателлитного методов анализа.

Выводы:

  1. Для растений одного клона были получены одинаковые электрофоретические спектры ампликонов, что указывает на отсутствие микросателлитной нестабильности у проанализированных образцов и может являться свидетельством их генетической однородности.
  2. На основе исследования электрофореграмм продуктов амплификации микросателлитных локусов установлена плоидность образцов, которая соответствовала ранее полученным данным хромосомного анализа.
References

1. Alía L, Lüttschwager D, Ewald D. Investigation of gas exchange and biometric parameters in isogenic lines of poplar differing in ploidy. Silvae Genetica. 2015; 64(1-6): 46-59. DOI:10.1515/sg-2015-0004.

2. Jansons Ā., Zeps M., Rieksts–Riekstiņš J., Matisons R., Krišāns O. Height increment of hybrid aspen Populus tremuloides x P. tremula as a function of weather conditions in central part of Latvia. Silva Fennica. 2014; 48(5). DOI:10.14214/sf.1124.

3. Johansson T. Biomass production of hybrid aspen growing on former farm land in Sweden. Journal of Forestry Research. 2012; 24(2): 237-246. DOI:10.1007/s11676-012-0305-x.

4. Kaeppler S., Kaeppler H., Rhee Y. Epigenetic aspects of somaclonal variation in plants. Plant Gene Silencing. 2000: 59-68. DOI: 10.1007/978-94-011-4183-3_4.

5. Mashkina O. S. The formation of unreduced pollen in Populus exposed to high temperatures and chemical mutagens. Cytogenetic studies of forest trees and shrub species. Zagreb. 1997: 241-252.

6. Mason A. SSR Genotyping. Methods in Molecular Biology. 2014: 77-89. DOI: 10.1007/978-1-4939-1966-6_6.

7. Miguel C., Marum L. An epigenetic view of plant cells cultured in vitro: somaclonal variation and beyond. J. Exp. Bot. 2011; 62(11): 3713-3725. DOI:10.1093/jxb/err155.

8. Politov D., Belokon Y., Shatokhina A. (et al.) Molecular identification and karyological analysis of a rampant aspen Populus tremula L. (Salicaceae) Clone. Int J Plant Genomics. 2017; 2017: 1-8. DOI:10.1155/2017/5636314.

9. Rahman M., Dayanandan S., Rajora O. Microsatellite DNA markers in Populus tremuloides. Genome. 2000; 43(2): 293-297. DOI: 10.1139/g99-134.

10. Rahman M., Rajora O. Microsatellite DNA somaclonal variation in micropropagated trembling aspen (Populus tremuloides). Plant Cell Rep. 2001; 20(6): 531-536. DOI: 10.1007/s002990100365.

11. Sabatti M., Fabbrini F., Harfouche A. (et al.) Evaluation of biomass production potential and heating value of hybrid poplar genotypes in a short-rotation culture in Italy. Industrial Crops and Products. 2014; 61: 62-73. DOI: 10.1016/j.indcrop.2014.06.043.

12. Orlović S., Galović V., Zorić M. (et al.) Evaluation of interspecific DNA variability in poplars using AFLP and SSR markers. African Journal of Biotechnology. 2009; 8(20): 1-10. URL: https://www.ajol.info/index.php/ajb/article/view/65955.

13. Tuskan G., DiFazio S., Jansson S. (et al.) The genome of black cottonwood, Populus trichocarpa (Torr. & Gray). Science. 2006; 313(5793): 1596-1604. DOI:10.1126/science.1128691.

14. Wang Q., Wang L. An evolutionary view of plant tissue culture: somaclonal variation and selection. Plant Cell Rep. 2012; 31(9): 1535-1547. DOI: 10.1007/s00299-012-1281-5.

15. Yang S., Lu L., Ni Y. Cloned poplar as a new fibre resource for the Chinese pulp and paper industry. Pulp and Paper Canada. 2006; 107(2): 34-37.

16. Baranov O. Yu., Balyuckas V. Ispol'zovanie molekulyarno-geneticheskih markerov dlya analiza ploidnosti osiny i berezy. Problemy lesovedeniya i lesovodstva. 2009;69: 689-696.

17. Bakri A. M. A review on somaclonal variation of Theobroma cacao L. IOP Conference Series: Earth and Environmental Science. IOP Publishing. 2019; 293: 012005. DOI:10.1088/1755-1315/293/1/012005.

18. Matveeva T. V., Pavlova O. A., Bogomaz D. I. (i dr.) Molekulyarnye markery dlya vidoidentifikacii i filogenetiki rasteniy. Ekologicheskaya genetika. 2011;9(1): 32-43.

19. Vyraschivanie posadochnogo materiala topolya belogo (Populus alba L.) na osnove kollekcii in vitro i ocenka ego sebestoimosti / O. S. Mashkina, T. M. Tabackaya, S. S. Morkovina [i dr.] // Lesotehnicheskiy zhurnal. – 2016. – T. 6. № 1. – S. 28–44. DOI: 10.12737/18725.

20. Mashkina O. S., Tabackaya T. M., Starodubceva L. M. Dlitel'noe mikrocherenkovanie dlya massovogo klonal'nogo razmnozheniya karel'skoy berezy i topolya. Fiziologiya rasteniy. 1999;46(6): 835-837.

21. Mashkina O. S., Fedulova T. P., Tabackaya T. M. (i dr.) Molekulyarno-geneticheskaya i citogeneticheskaya ocenka perspektivnyh gibridov i razmnozhennyh in vitro klonov topolya i osiny. Vestnik Voronezhskogo gosudarstvennogo universiteta. Seriya: Himiya. Biologiya. Farmaciya. 2016;2: 60-69.

22. Rusina L. M., Rusin N. S., Gorevalova S. Yu. Perspektivnye klony i gibridy osiny dlya sozdaniya plantacionnyh nasazhdeniy. Dostizheniya i problemy lesnoy genetiki i selekcii. 2010: 225-228.

23. Ryabushkina N. A., Omasheva M. E., Galiakparov N. N. Specifika vydeleniya DNK iz rastitel'nyh ob'ektov. Eurasian Journal of Applied Biotechnology. 2012;2: 9-26.

24. Shamina Z. B. Osobennosti geneticheskoy izmenchivosti somaticheskih kletok rasteniy. Biotehnologiya. 1987; 3(3): 361.